Por mucha diversidad morfológica que presentemos los seres vivos, todos nos encontramos aunados bajo un mismo paraguas: nuestra unidad funcional básica es la célula. Si un ser vivo posee una célula sobre la cual se basa su estructura morfológica entera, este se conoce como unicelular (el caso de protozoos o bacterias), mientras que los que presentamos varias (de unos cientos a cientos de billones) somos seres pluricelulares.

Así pues, todo organismo parte de la célula y, por ello, algunos entes moleculares como los virus no se consideran estrictamente “vivos” desde un punto de vista biológico. A su vez, estudios han caracterizado que cada célula contiene la friolera de 42 millones de moléculas proteicas. Por ello, no es de extrañar que se calcule que el 50% del peso de los tejidos vivos en seco estén compuestos únicamente por proteínas.

¿Por qué aportamos todos estos datos aparentemente inconexos? Hoy venimos a desentrañar el secreto de la vida: el código genético. Por misterioso que pueda resultar a primera vista, te aseguramos que entenderás este concepto inmediatamente. De células, proteínas y ADN va la cosa. Quédate para descubrirlo.

¿Qué es el código genético?

Empezamos de forma clara y concisa: el código genético no es más que el conjunto de instrucciones que le indican a la célula cómo hacer una proteína específica. Ya hemos dicho en líneas previas que las proteínas son la unidad estructural esencial de los tejidos vivos, razón por la cual no estamos ante una cuestión anecdótica: sin proteínas no existe la vida, así de simple.

Las características del código genético fueron establecidas en el año 1961 por Francis Crick, Sydney Brenner y otros biólogos moleculares colaboradores. Este término se basa en una serie de premisas, pero antes debemos aclarar ciertos términos para entenderlas. Vamos a ello:

  • ADN: ácido nucleico que contiene las instrucciones genéticas usadas en el desarrollo y funcionamiento de todos los organismos vivos existentes.
  • ARN: ácido nucléico que desempeña diversas funciones, entre las que se encuentra el dirigir las etapas intermedias de la síntesis proteica.
  • Nucleótidos: las moléculas orgánicas que, unidas, dan lugar a las cadenas de ADN y ARN de los seres vivos.
  • Codón o triplete: cada 3 aminoácidos formadores del ARN forman un codón, es decir, un triplete de información genética.
  • Aminoácido: moléculas orgánicas que, en cierto orden, dan lugar a las proteínas. 20 aminoácidos están codificados en el código genético.

Las bases del código genético

Una vez tenemos claro estos términos tan básicos, es hora de que exploremos las características principales del código genético, establecidas por Crick y sus compañeros. Estas son las siguientes:

  • El código está organizado en tripletes o codones: cada tres nucleótidos (codón o triplete) codifica un aminoácido.
  • El código genético es degenerado: existen más tripletes o codones que aminoácidos. Esto quiere decir que un aminoácido suele estar codificado por más de un triplete.
  • El código genético no es solapado: un nucleótido solamente pertenece a un único triplete. Es decir, un nucleótido específico no está en dos codones a la vez.
  • La lectura es “sin comas”: no queremos incurrir en terminología demasiado compleja, así que diremos que no hay “espacios” entre los codones.
  • El código genético nuclear es universal: el mismo triplete en diferentes especies codifica para el mismo aminoácido.

Desentrañando el código genético

Ya tenemos las bases terminológicas y los pilares teóricos. Ahora toca ponerlos en práctica. En primer lugar, te diremos que cada nucleótido recibe un nombre basado en una letra, la cual viene condicionada por la base nitrogenada que este presenta. Las bases nitrogenadas son las siguientes: adenina (A), citosina (C), guanina (G), timina (T) y uracilo (U). La adenina, la citosina y la guanina son universales, mientras que la timina es única del ADN y el uracilo es exclusivo del ARN. Si ves esto, ¿qué crees que significa?:

CCT

CCU

Toca recuperar los términos antes descritos. CCT es parte de una cadena de ADN, es decir, 3 nucleótidos distintos: uno con la base citosina, otro con la base citosina y otro con la base timina. En el segundo caso de letras en negrita estamos ante un codón, ya que es la información genética de ADN “taducida” (de ahí que haya un uracilo donde antes había una timina) en una cadena de ARN.

Así pues, podemos afirmar que CCU es un codón que codifica para el aminoácido prolina. Como hemos dicho anteriormente, el código genético es degenerado. Así pues, el aminoácido prolina también viene codificado por otros codones con diferentes nucleótidos: CCC, CCA, CCG. Entonces, el aminoácido prolina está codificado por un total de 4 codones o tripletes.

Cabe destacar que no es que se necesiten los 4 codones para codificar el aminoácido, si no que cualquiera de ellos vale. En general, los aminoácidos esenciales están codificados por 2,3,4 o 6 codones diferentes, excepto la metionina y el triptófano que solo responden a uno cada una.

¿Por qué tanta complejidad?

Hagamos cálculos. Si cada codón estuviera codificado únicamente por un nucleótido, solo se podrían formar 4 aminoácidos distintos. Esto haría de la síntesis proteica un proceso imposible, pues en general cada proteína está compuesta de unos 100-300 aminoácidos. Solo existen 20 aminoácidos englobados en el código genético, pero estos se pueden ordenar de distintas formas a lo largo de la “cadena de montaje” para dar lugar a las distintas proteínas presentes en nuestros tejidos.

Por otro lado, si cada codón estuviera formado por dos nucleótidos, el número total de “dipletes” posible sería 16. Seguimos lejos de la meta. Ahora bien, si cada codón estuviera formado por tres nucleótidos (como es el caso), el número de permutaciones posibles aumentaría a 64. Teniendo en cuenta que hay 20 aminoácidos esenciales, con 64 codones da para codificar cada uno de ellos y, encima, ofrecer distintas variaciones en cada caso.

Una mirada aplicada

Se nos acaba el espacio, pero es que es verdaderamente complejo concentrar tanta información en unas pocas líneas. Síguenos en el siguiente esquema, pues te prometemos que cerrar todo este conglomerado terminológico es mucho más sencillo de lo que parece:

CCT (ADN) → CCU (ARN) → Prolina (ribosoma)

Este pequeño diagrama nos expresa lo siguiente: el ADN celular contiene los 3 nucleótidos CCT, pero este no puede “expresar” la información genética, ya que se encuentra aislado de la maquinaria celular en el núcleo de la misma. Por ello, la enzima ARN polimerasa se encarga de TRANSCRIBIR (proceso conocido como transcripción) los nucleótidos de ADN en nucleótidos de ARN, los cuales formarán el ARN mensajero.

Ahora ya tenemos el codón CCU en el ARN mensajero, el cual viajará fuera del núcleo a través de sus poros hasta el citosol, donde se encuentran los ribosomas. De forma resumida, podemos decir que el ARN mensajero le otorga esta información al ribosoma, el cual “entiende” que debe adicionarse el aminoácido prolina a la secuencia de aminoácidos ya construida para dar lugar a una proteína concreta.

Como hemos dicho anteriormente, una proteína está compuesta por unos 100-300 aminoácidos. Así pues, una proteína cualquiera formada a partir de la ordenación de 300 aminoácidos, vendrá codificada por un total de 900 tripletes (300x3) o, si lo prefieres, por 2.700 nucleótidos (300x3x3). Ahora, imagínate cada una de las letras de cada uno de los 2.700 nucleótidos, algo como: AAAUCCCCGGUGAUUUAUAAGG (...) Es esta ordenación, este conglomerado de letras, lo que realmente es el código genético. Más fácil de lo que parecía en un principio, ¿verdad?

Resumen

Si nos preguntáis a cualquier biólogo interesado por la biología molecular sobre el código genético, seguramente tendréis conversación durante unas 4-5 horas. Resulta verdaderamente fascinante conocer que el secreto de la vida, por irreal que parezca, se encuentra encerrado en una sucesión específica de “letras”.

Así pues, el genoma de cualquier ser vivo se puede mapear con estas 4 letras. Por ejemplo, según el proyecto genoma humano, toda la información genética de nuestra especie está compuesta por 3.000 millones de pares de bases (nucleótidos), los cuales se encuentran en los 23 pares de cromosomas dentro del núcleo de todas nuestras células. Desde luego, por diferentes que seamos los seres vivos, todos presentamos un “lenguaje” común.

Referencias bibliográficas:

  • ¿Qué es el código genético? genotipia.com. Recuperado de: https://genotipia.com/codigo-genetico/
  • Asimov, I., & de la Fuente, A. M. (1982). El código genético (No. Sirsi) i9789688561034). Plaza & Janés.
  • Código genético, National Human Genome Research Institute. Recuperado de: https://www.genome.gov/es/genetics-glossary/Codigo-genetico
  • Código genético: características y desciframiento, Universidad Complutense de Madrid (UCM). Recuperado de: https://www.ucm.es/data/cont/media/www/pag-56185/08-C%C3%B3digo%20Gen%C3%A9tico-caracter%C3%ADsticas%20y%20desciframiento.pdf
  • El código genético, Khanacademy.org. Recuperado de: https://es.khanacademy.org/science/ap-biology/gene-expression-and-regulation/translation/a/the-genetic-code-discovery-and-properties
  • Es oficial: hay 42 millones de moléculas de proteína en cada célula, europapress.com. Recuperado de: https://www.europapress.es/ciencia/laboratorio/noticia-oficial-hay-42-millones-moleculas-proteina-cada-celula-20180117181506.html
  • Lee, T. F. (1994). El Proyecto Genoma Humano: rompiendo el código genético de la vida (No. Sirsi) i9788474325072).